ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:126
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:54:48
Modification date:20-SEP-2005 15:09:07
 
Regulatory sequence name:b3, artificial
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:artificial, (e.g., transgenic mouse)
Binding factors:SRp40
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:TCGACATTGGGAGCAGTCGGCTCGTGC
Mutated regulatory sequence:
 
Methods:SELEX
Keywords:
 
Citation line:Tacke, R., Chen, Y. and Manley, J.L. (1997) Sequence-specific RNA binding by an SR protein requires RS domian phosphorylation: creation of an SRp40-specific splicing enhancer. Proc. Natl. Acad. Sci. USA, 94, 1148-1153.
PubMed ID:9037021
 
Comments:
(activated in workbench):Y
spacer

spacer