ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:124
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:51:28
Modification date:20-SEP-2005 15:03:24
 
Regulatory sequence name:cardiac troponin t exon 17
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Gallus gallus, chicken
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:GTAAGTACAGGCTGCATGCCTCCCACCACACCTGTGCTGCATGGACACCTGGGGCTGACCTTGCAACAGAAGTGGGGCTGAGGGAAGGACTGTCCTGGGGACTGGTGTCAGAGCGGGGTTGGTGACTCTCAGGATGCCCAAAACACCCA
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Keywords:
 
Citation line:Carlo, T., Sterner, D.A. and Berget, S.M. (1996) An intron splicing enhancer containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon. RNA, 2, 342-353.
PubMed ID:8634915
 
Comments:
(activated in workbench):Y
spacer

spacer