ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:121
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:47:46
Modification date:27-JAN-2005 09:36:30
 
Regulatory sequence name:hiv exon 3
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Unknown
Binding factors:hnRNP A/B
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:TTAGGACGTATAGTTAGTCCTAGG
Mutated regulatory sequence:
 
Methods:Mutagenesis
Keywords:
 
Citation line:Bilodeau, P. S., J. K. Domsic, A. Mayeda, A. R. Krainer, and C. M. Stoltzfus. 2001. RNA splicing at human immunodeficiency virus type 1 3' splice site A2 is regulated by binding of hnRNP A/B proteins to an exonic splicing silencer element. J.Virol. 75:8487-8497.
PubMed ID:11507194
 
Comments:ESSV
(activated in workbench):Y
spacer

spacer