ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:118
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:44:16
Modification date:20-SEP-2005 14:07:05
 
Regulatory sequence name:bdv polymerase exon
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Unknown
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:CTAGATATGGATCCCGACTTCAACGATATTGTTAG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Tomonaga, K., T. Kobayashi, B. J. Lee, M. Watanabe, W. Kamitani, and K. Ikuta. 2000. Identification of alternative splicing and negative splicing activity of a nonsegmented negative-strand RNA virus, Borna disease virus. Proc.Natl.Acad.Sci.U.S.A 97:12788-12793.
PubMed ID:11070091
 
Comments:
(activated in workbench):Y
spacer

spacer