ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:115
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:42:20
Modification date:19-SEP-2005 18:14:42
 
Regulatory sequence name:mypt1, exon3
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Gallus gallus, chicken
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:TGAATGAAGGTCCTACATCCT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Dirksen, W. P., S. A. Mohamed, and S. A. Fisher. 2003. Splicing of a myosin phosphatase targeting subunit 1 alternative exon is regulated by intronic cis-elements and a novel bipartite exonic enhancer/silencer element. J.Biol.Chem. 278:9722-9732.
PubMed ID:12509424
 
Comments:
(activated in workbench):Y
spacer

spacer