ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:114
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:41:33
Modification date:19-SEP-2005 15:46:26
 
Regulatory sequence name:xi collagen exon 6b
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Mus musculus, mouse
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:CAAGCATCAGCAAAAGCCAAAC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Chen, Y., H. Sumiyoshi, J. T. Oxford, H. Yoshioka, F. Ramirez, and N. P. Morris. 2001. Cis-acting elements regulate alternative splicing of exons 6A, 6B and 8 of the alpha1(XI) collagen gene and contribute to the regional diversification of collagen XI matrices. Matrix Biol. 20:589-599.
PubMed ID:11731275
 
Comments:
(activated in workbench):Y
spacer

spacer