ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:11
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:13-SEP-2004 14:37:18
Modification date:20-SEP-2005 13:11:30
 
Regulatory sequence name:igm exon m2
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Mus musculus, mouse
Binding factors:U2 snRNA
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:GAAGGACAGCAGAGACCAAGAGA
Mutated regulatory sequence:
 
Methods:In vitro splicing assay
Keywords:
 
Citation line:Tanaka, K., Watakabe, A. and Shimura, Y. (1994) Polypurine sequences within a downstream exon function as a splicing enhancer. Mol. Cell. Biol., 14, 13471354. Kan JL, Green MR., Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor. Genes Dev. 1999 Feb 15;13(4):462-71.
PubMed ID:8289812 , 10049361
 
Comments:
(activated in workbench):Y
spacer

spacer