ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:105
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:18:32
Modification date:19-SEP-2005 12:18:33
 
Regulatory sequence name:ncam exon 17
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Mus musculus, mouse
Binding factors:SR protein
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:GGGGGGAAGCACACAGAGCCCAACGAGACCAC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Cote, J., M. J. Simard, and B. Chabot. 1999. An element in the 5' common exon of the NCAM alternative splicing unit interacts with SR proteins and modulates 5' splice site selection. Nucleic Acids Res. 27:2529-2537.
PubMed ID:10352182
 
Comments:
(activated in workbench):Y
spacer

spacer